A Survey for Two Major Grapevine
Viruses in Georgian Vineyards, Caucasus Region
Tinatin Elbakidze1,2*, Dali Gaganidze1,
Mariam Aznarashvili1 and Ketevan Badalashvili1
1Plant Pest Diagnostics Department, Laboratory of Molecular Biology, LEPL
- State Laboratory of Agriculture, 0159, Tbilisi, Georgia
2School of Science and Technology,
University of Georgia, 0171 Tbilisi, Georgia
*For correspondence: t.elbakidze@yahoo.com
Received 27 January 2022; Accepted 08 June 2022;
Published 25 August 2022
Abstract
This study represents the distribution of Grapevine fleck and G. fanleaf viruses in the
vineyards of the Kakheti region, the number one winemaking area in the republic
of Georgia and highlights the benefit of the timely identification of
phytopathogens using reliable laboratory assays. The main goal of the proposed
study was to identify grapevine viruses in two prominent cultivars: Rkatsiteli and Saperavi. A survey was conducted in the 2020–2021 growing seasons.
In total 600 grapevine samples were collected from 30 vineyards and analyzed
using Double-antibody sandwich enzyme-linked immunosorbent assay (Das-ELISA)
and One-Step RT-PCR analysis. Out of 123 positive samples 112 tested positive
for G. fleck virus and 11- for G. fanleaf virus respectively based on
Das-ELISA assay. Mix infection was demonstrated in 2 tested Saperavi cultivars. G. fleck virus was prevalent and both viruses were predominantly
distributed in the Saperavi cultivar.
Randomly selected 28 positive and 20 negative samples were further confirmed
using a One-Step RT-PCR assay that revealed the effectiveness of Das-ELISA. A
comprehensive diagnosis is important for controlling grapevine viruses and
helps develop regulatory measures further to establish improved strategies for
using virus-free planting materials. © 2022 Friends Science Publishers
Keywords: Vitis vinifera L.; Grapevine viruses;
Viral disease; Serological assay; Molecular assay
Introduction
Grapevine fanleaf virus (GFLV) and Grapevine fleck virus
(GFkV) are one of the most widely distributed and economically significant
phytopathogens affecting wine grapes (Vitis
vinifera L.) (Bahder et al. 2013; Martelli 2017). GFLV is a soil-borne viral pathogen of
grapevines responsible for fanleaf degeneration (Bovey et al. 1990; Martelli and Savino 1990; Martelli 2014; Zherdev et al. 2018). The disease occurs
worldwide in most temperate grapevine distributed regions (Andret-Link et al. 2004; Maliogka et al. 2015) and is transmitted via ectoparasitic nematode Xiphinema
index with the propagating
material (Martelli and Savino 1990; Villate et al. 2008). Symptoms caused by GFLV in grapevines may differ in
patterns and severity and may include distorted, asymmetrical leaves, chlorotic
mottling, and yellow mosaic (Martelli and Sovino 1990). GFkV is associated with
the fleck disease complex with the ability of non-mechanical transmission
(Bahder et al. 2013). GFkV is only
found in the phloem and is transmitted through propagation and grafting (Sabanadzovic
et al. 2001; Kanuya et al. 2012; Poojari et al. 2016; Zherdev et al. 2018). There are no reported
vectors for GFkV. Disease caused by GFkV has been linked with reduced growth
and low quality of wood for propagation. Foliage fleck symptoms including
clearing of the veinlets and mosaic patterns with distorted leaves can be
observed during GFkV infection (Fajardo et
al. 2012; Martelli 2014). Georgia is considered the birthplace of wine as
studies revealed evidence of cultivating grapevines during the early Neolithic
Period from Georgia’s country (McGovern et
al. 2017). Nowadays Georgia is home to about 500 varieties of indigenous
grapes that make up one-sixth of the world’s total grapevine varieties. The
country has up to 50,000 hectares of grapes, consisting of 75% white grapes and
25%-red respectively including endangered vines only found in Georgia.
Georgia’s number one winemaking area is the Kakheti region situated in the east
part of the country comprising nearly 80 grape varieties, including the two
most prominent – Rkatsiteli (white)
and Saperavi (red) cultivars (Wines
Georgia 2021). The main goal of this study was to survey vineyards in the
Kakheti region to detect the presence of GFkV and GFLV in two main Rkatsiteli and Saperavi cultivars. Therefore, a better evaluation regarding the
distribution of grapevine viruses in eastern Georgia and the assessment of the
impact with the economic consequences to the winegrape industry can be done.
Correspondingly, as a wine-producing area, it’s reasonable to have information
regarding the dissemination of grapevine viruses in eastern Georgia to take all
the necessary measures for the subsequent elimination of the grapevine viruses.
Materials
and Methods
Survey
and sampling
To investigate the status of virus infection in wine
grape vineyards in the Kakheti region, 600 grapevine samples (including 300 Rkatsiteli and 300 Saperavi cultivars) from a total of 30 different vineyards (20
samples for each vineyard) were collected from June to October 2020–2021. As
the distribution of grapevine viruses can be uneven in grapevine tissue
according to the season and tissue source (Martelli and Sovino 1990; Constable
and Randoni 2011) mature basal leaves with petioles and veins were collected
and placed in sealed plastic bags for further transportation. A survey was
conducted based on typical symptoms as well as randomly as grapevines can be
completely symptomless. Collected samples were stored at 4°C maximum of 2–3
days for serological analysis and up to 1 week for further molecular analyses.
Serological
analysis
Das-ELISA (BIOREBA AG, Reinach, Switzerland) was
performed for the detection of GFkV and GFLV. Samples of grapevines fitted in
extraction plastic bags (BIOREBA) were homogenized in the special extraction
buffer “Grapevine” (Tris base 200 mM,
NaCl 137 mM, PVP K25 2% (w/v), PEG
6000 1% (w/v), NaN3 0.02% (w/v), Tween 20 0.05% (w/v); pH 8.2) at a ratio of
1:10 (w/v). The test reaction was performed on 96 well plates according to
manufacturers’ instructions. Appropriate OD405/492 values were
obtained after the run of the samples into the Elisa Reader Optic Ivymen®
system 2100-C.
RNA
extraction
RNA was extracted from randomly selected 28 positive and
20 negative plant samples previously tested by Das-ELISA. Plant RNA
Purification kit (OxGEn molecular solutions® Georgia) was used to isolate RNA
from the tested samples. Following the recommendations preparing the lysate,
binding, washing, and the final elution steps were done as it is described in
the manufacturers’ instructions. Extracted RNA concentration was assessed with
a Qubit® RNA HS Assay Kit using a Qubit 3.0 fluorometer (Thermofisher
Scientific) following the manufacturers’ instructions.
One-step
RT-PCR analysis
SuperScriptTM IV One-Step RT-PCR System (Invitrogen by
Thermo Fisher Scientific) was used to perform revers-transcription (RT) and PCR
steps continuously in one tube. The reaction mix was prepared as per the
manufacturer’s instructions. The assay was performed in a 50 μL mixture containing 25 μL 2×Platinum SuperFi RT-PCR Master
Mix, 0.5 μL SuperScript IV RT
Mix, 2.5 μL of each primer, up
to 50 ng/μL template RNA and an
appropriate volume of nuclease-free water to fill up the reaction mix up to 50 μL. Corresponding primers (Table 1)
were used at final concentrations of 10 μM.
The reaction mix was placed in the thermal cycler (SymplyAmp Applied
biosystems) preprogrammed as follows: 1 cycle of RT at 50˚C for 10 min and
RT inactivation/initial denaturation at 98˚C for 2 min, followed by 40
cycles of amplification at 98˚C for 10 s, 61˚C (GFLV), 70˚C (GFkV)
for 10 s and 72˚C for 30 s and a final extension at 72˚C for 5 min.
The appropriate annealing temperature for the used primers was defined using
the Tm calculator (Thermo Fisher). Pre-stained 1% Agarose gel (UltraPureTM
Agarose; Invitrogen) with ethidium bromide (Invitrogen) was prepared using TAE
buffer (20 mM sodium acetate, 1 mM EDTA pH 8.0, 40 mM Tris base) in order to analyze obtained PCR amplicons by agarose
gel electrophoresis. Visualization of PCR amplicons was done in the SMART 5 VWR
gel documentation system. RT-PCR run consisted of samples without RNA,
molecular grade water, and the negative sample obtained from Das-ELISA assay as
negative controls.
Results
As a result, 600 grapevine samples from 30 vineyards
covering different villages of the Kakheti region were tested for the presence
of GFkV and GFLV. Notably, no symptoms of the viral infection were observed in
the case of GFLV positive, while some
symptoms were observed only in a few GFkV positive grapevine samples including
leaf yellowing and mosaic pattern (Fig. 1).123 (20.5%) samples resulted as
positive by Das-ELISA for both surveyed viruses among them 74 for Saperavi cultivar and 49 for Rkatsiteli respectively. 112 samples
(18.7%) tested positive for GFkV with an infection rate from 0.0 to 50% and
only 11 samples (1.8%) tested positive for GFLV where the infection rate varied
from 0.0 to 15% in both surveyed grapevine cultivars. The study showed that GFkV
was predominantly distributed in Saperavi
cultivar consisting of 65 samples out of 112 Das-ELISA positives while in Rkatsiteli cultivar GFkV was found in 47
samples respectively. Regarding GFLV out of 11 positive 2 samples were seen in Rkatsiteli cultivar whereas the rest 9
samples were found in Saperavi
cultivar (Table 2). Mix infections were demonstrated only in Saperavi cultivar where both viral
agents were detected in 2 tested samples. The percentages of positive samples
in the two surveyed cultivars are shown in Fig. 2. Twenty-eight positive samples obtained from Das-ELISA assay including 22 GFkV positive samples from 12 Rkatsiteli and 10 Table 1: The primers used in One-Step RT-PCR to amplify the
RNA-dependent RNA polymerase (RDRP) and coat protein (CP) genes. Viruses
included GFkV and GFLV F (forward) and R (reverse) primers
Virus |
Primer's ID |
Fragment length (nt) |
Gene |
Sequence (5’-3’) |
Reference |
GFLV |
GFLV-V1/F |
322 |
CP gene |
ACCGGATTGACGTGGGTGAT |
Sànchez et al.
(1991) |
GFLV-C1/R |
CCAAAGTTGGTTTCCCAAGA |
||||
GFkV |
GFkV-585/F |
533 |
RdRP gene |
CTCAGCCTCCACCTTGCCCCGT |
Naidu and
Mekuria (2010) |
GFkV-1117/R |
CAATTTGGCTGGGCGAGAAGTACA |
Table 2: Vineyards
surveyed for GFkV and GFLV viruses in the Kakheti region. Samples tested by
Das-ELISA and One-Step RT-PCR are presented
Regions |
Cultivar |
No. of vineyards surveyed |
GFkV |
GFLV |
||||
No. of
ELISA positive samples/tested samples |
Infection
rate (%) |
No. of PCR
positive samples/tested samples |
No. of
ELISA positive samples/tested samples |
Infection
rate (%) |
No. of PCR
positive samples/tested samples |
|||
Ikalto |
Rkatsiteli |
1 |
8/20 |
40 |
1/1 |
0/20 |
0 |
0 |
Koghoto |
Rkatsiteli |
1 |
3/20 |
15 |
1/1 |
0/20 |
0 |
0 |
Alvani |
Rkatsiteli |
1 |
8/20 |
40 |
1/1 |
0/20 |
0 |
0 |
Napareuli |
Rkatsiteli |
1 |
5/20 |
25 |
1/1 |
0/20 |
0 |
0 |
Kvareli |
Rkatsiteli |
1 |
6/20 |
30 |
1/1 |
0/20 |
0 |
0 |
Telavi |
Saperavi |
5 |
19/100 |
19 |
3/3 |
3/100 |
3 |
1/1 |
Alvani |
Saperavi |
1 |
10/20 |
50 |
1/1 |
1/20 |
5 |
1/1 |
Pshaveli |
Saperavi |
1 |
8/20 |
40 |
1/1 |
0/20 |
0 |
0 |
Napareuli |
Saperavi |
1 |
5/20 |
25 |
1/1 |
0/20 |
0 |
0 |
Akhmeta |
Rkatsiteli |
1 |
0/20 |
0 |
0 |
0/20 |
0 |
0 |
Akhshani |
Rkatsiteli |
1 |
1/20 |
5 |
1/1 |
0/20 |
0 |
0 |
Ruispiri |
Rkatsiteli |
1 |
2/20 |
10 |
1/1 |
0/20 |
0 |
0 |
Gulgula |
Rkatsiteli |
1 |
1/20 |
5 |
1/1 |
1/20 |
5 |
1/1 |
Telavi |
Rkatsiteli |
1 |
0/20 |
0 |
0 |
0/20 |
0 |
0 |
Tsinandali |
Saperavi |
1 |
0/20 |
0 |
0 |
0/20 |
0 |
0 |
Shakriani |
Saperavi |
2 |
0/40 |
0 |
0 |
0/40 |
0 |
0 |
Akhmeta |
Saperavi |
1 |
6/20 |
30 |
1/1 |
2/20 |
10 |
1/1 |
Akura |
Rkatsiteli |
1 |
6/20 |
30 |
1/1 |
0/20 |
0 |
0 |
Vanta |
Rkatsiteli |
1 |
2/20 |
10 |
1/1 |
0/20 |
0 |
0 |
Tsinandali |
Rkatsiteli |
1 |
3/20 |
15 |
1/1 |
1/20 |
5 |
1/1 |
Busheti |
Rkatsiteli |
1 |
0/20 |
0 |
0 |
0/20 |
0 |
0 |
Kisiskhevi |
Rkatsiteli |
1 |
2/20 |
10 |
1/1 |
0/20 |
0 |
0 |
Nasamkhrali |
Saperavi |
1 |
1/20 |
5 |
1/1 |
3/20 |
15 |
1/1 |
Shalauri |
Saperavi |
1 |
10/20 |
50 |
1/1 |
0/20 |
0 |
0 |
Kondoli |
Saperavi |
1 |
6/20 |
30 |
1/1 |
0/20 |
0 |
0 |
Saperavi vineyards (one sample per vineyard) and six
GFLV positive samples from 2 Rkatsiteli
and 4 Saperavi vineyards were
randomly selected and confirmed to be positive for GFkV and GFLV by One-Step RT-PCR using GFkV and GFLV specific primers (Table 2).
Furthermore, randomly selected twenty
Das-ELISA negative samples
were
also analyzed by One-Step RT-PCR and tested
negative for both viruses. Agarose gel electrophoresis
ascertained
a single DNA fragment with
appropriate size while negative controls remained without any amplification (Fig. 3).
Discussion
The prevalence of GFkV could be explained by using
infected plant materials as there is no vector revealed for this virus. GFLV
had a limited distribution compared to the GFkV as also described in previous
studies (Basso et al. 2017; Porotikova et al. 2021). The reason
that GFLV incidence is low could be the absence of occurrence of its vector
(nematode: Xiphinema index), grapevine cultivated soils in vineyards
that may not encourage the survival of the nematode, also it could be
associated with the limited existence of GFLV in propagated grapevine materials
that are used to establish new vineyards. Overall analysis showed that within
two tested viral species, GFkV was prevalent and both viruses were
predominantly distributed in Saperavi cultivar while the opposite trend
was seen for the Rkatsiteli cultivar where lower prevalence for both
viral agents was detected. Regardless
of those symptoms observed only in a few GFkV positive grapevine samples
including leaf yellowing and mosaic pattern it cannot be said that they were
the result of GFkV infection as symptomless V.
vinifera is common unless the virus infects Vitis rupestris cv.’St. George’ (Fajardo et al. 2012) cultivar. Although there are reported studies on the
distribution of grapevine viruses such as GLRaV-1,
GLRaV-3 and GVA in Georgian
vineyards (Megrelishvili et al.
2016), the aforementioned symptoms cannot be assigned even to those viral
pathogens until applying of molecular techniques for further confirmation is
done. The occurrence of both etiological viral agents was
Fig. 1: (A), (B) and (C) grapevine
samples from GFkV positive Saperavi cultivars;
(D) grapevine sample from GFkV
positive Rkatsiteli cultivar
Fig. 3:
Amplification of the expected 533 nt. (A;
B) DNA fragments with GFkV-specific
primer pair GFkV-585/F-1117/R and 322 nt (C)
DNA fragments with GFLV-specific primer pair GFLV-V1/F- C1/R resulted from
One-Step RT-PCR; M: 100 bp DNA ladder; (A)
Lanes: 1-3 Negative controls; Lanes 4–9 GFkV positive samples in Saperavi; (B) Lanes: 1-6 GFkV positive samples in Rkatsiteli; (C) Lane: 1-
GFLV positive sample in Rkatsiteli;
Lane: 2- GFLV positive sample in Saperavi;
Lanes: 3-5 Negative controls
Fig. 2: Distribution
of grapevine viruses in two main cultivars: Rkatsiteli
and Saperavi (Percentage of
plants positive and negative for both viruses by Das-ELISA assay are presented)
established
using serological and molecular methods. Obtained
results showed that the extracted RNAs and the synthesized cDNA templates were
free of extra contaminants, resulting in a high level of RNA and DNA
preparations produced for gene expression level assays by One-Step RT-PCR
indicating high sensitivity of molecular-based approaches as well as
reliability and effectiveness of Das-ELISA assay. The benefit of Das-ELISA was to avoid false
negatives in case of weakly positive samples with an antigen concentration near
the detection limit and therefore allowed taking full advantage of the sensitivity
of the Das-ELISA test.
Conclusion
The study has revealed the
presence of grapevine viruses in surveyed vineyards in the east part of
Georgia. Within the tested grapevines, most of the GFkV positive and all of the
GFLV positive samples were symptomless. Thus, it is of high importance to apply
appropriate, reliable and sensitive diagnostic assays for timely detection of
the viral agents distributed in the vineyards. Das-ELISA can be employed in
routine diagnostic tests for large-scale screening as it has been shown to be a
consistent and effective tool for testing samples. Laboratory diagnostic assay
such as the PCR technique should be applied to validate and confirm the results
obtained from the serological method. The presence
of single and mixed virus infection underscores the need for further
investigation of the vineyards for the presence of other economically
significant grapevine viruses. The health status of grapevines in vineyards
should receive appropriate attention to prevent the dissemination of viral
etiological agents, improve regulatory measures and establish management of
using “clean” planting materials from laboratory-tested vines. A comprehensive
diagnosis is important for the effective control of grapevine viruses and
further for the control of certified propagation material with virus-free
status as it is the only trustworthy and credible strategy to control and
prevent the spread of the diseases in viticulture.
Acknowledgments
This research was supported by the Shota Rustaveli
National Science Foundation of Georgia (SRNSFG) (grant number YS-19-2445).
Author Contributions
All authors contributed equally to this work.
Conflict of Interest
All authors declare that they have no competing
interests and that all co-authors have agreed to have seen and approved the
manuscript for submission
Data Availability
The data are available with the authors
Ethics Approval
Authors declare that the study does not involve research
neither on the human nor on live animal studies
References
Andret-Link P, C Laporte, L Valat, C Ritzenthaler, G
Demangeat, E Vigne, V Laval, P Pfeiffer, C Stussi-Garaud, M Fuchs (2004). Grapevine fanleaf virus: Still a major threat to the
grapevine industry. J Plant Pathol
3:183‒195
Bahder BW, O Alabi, S Poojari, DB Walsh, RA Naidu (2013). A survey for
grapevine viruses in Washington State ‘Concord’ (Vitis×labruscana L.)
vineyards. Plant Health Progr 1:16–22
Basso MF, TV Fajardo, P Saldarelli (2017). Grapevine virus diseases: Economic
impact and current advances in viral prospection and management. Rev Bras Fruticult 39:1–22
Bovey R, W Gärtel, WB Hewitt, GP Martelli, A Vuittenez (1990).
Soil-borne viruses transmitted by nematodes. In: Virus and Virus-like Diseases of Grapevines, pp:46‒50. Bovey R, W Gärtel, WB Hewitt, GP
Martelli, A Vuittenez (Eds). Editions Payot, Lausanne, Switzerland
Constable F, B Randoni (2011). Rugose wood associated viruses. Grape
and wine research and development corporation. Available
at: https://www.wineaustralia.com/getmedia/b49bbcf2-3619-43c2-a7d0-d22e8f3eda77/201106-Rugose-wood-associated-viruses?ext=.pdf
(Accessed: June 2011)
Fajardo TVM, M Eiras, O Nickel, CR Dubiela, ERD Souto (2012). Detection
and partial molecular characterization of Grapevine
fleck virus, Grapevine virus D, Grapevine leafroll-associated virus-5 and-6
infecting grapevines in Brazil. Cienc Rur
12:2127‒2130
Kanuya E, LA Clayton, RA Naidu, AV Karasev (2012). First report of Grapevine fleck virus in Idaho
grapevines. Plant Dis 11:1705‒1705
Maliogka VI, GP Martelli, M Fuchs, NI Katis (2015). Control of viruses
infecting grapevine. Adv Vir Res
91:175‒227
Martelli GP (2017). An Overview on Grapevine Viruses, Viroids and the
Diseases They Cause. In: Grapevine
Viruses: Molecular Biology, Diagnostics and Management, pp:31‒46. Meng B, GP Martelli, DA Golino, M
Fuchs (Eds). Springer International Publishing, Switzerland
AG
Martelli GP (2014). Directory of virus and virus-like diseases of the
grapevine and their agents. J Plant
Pathol 96:1‒136
Martelli GP, V Savino (1990). Fanleaf degeneration. In: Compendium of Grape Diseases, pp:48‒49. Pear Pearson RC, A Goheen (Eds). APS
Press, St. Paul, Minnesota, USA
McGovern P, M Jalabadze, S Batiuk, MP Callahan, KE Smith, GR Hall, D
Lordkipanidze (2017). Early neolithic wine of Georgia in the South Caucasus. Proc Natl Acad Sci 48:10309‒10318
Megrelishvili I, Z Khidesheli, L Ujmajuridze, N Chikovani (2016). The
study of viral diseases in Georgian vine grafted nurseries. Intl J Dev Res 7:8299‒8302
Naidu RA, TA Mekuria (2010). First report of grapevine fleck virus from Washington vineyards. Plant Dis 6:784
Poojari S, T Lowery, M Rott, AM Schmidt, N DeLury, J Boulé, JR
Úrbez-Torres (2016). First report and prevalence of Grapevine fleck virus in grapevines (Vitis vinifera) in Canada. Plant
Dis 5:1028
Porotikova E, U Terehova, V Volodin, E Yurchenko, S Vinogradova (2021).
Distribution and genetic diversity of grapevine viruses in russia. Plants 6:1080
Sabanadzovic S, NA Ghanem-Sabanadzovic, P Saldarelli, GP Martelli
(2001). Complete nucleotide sequence and genome organization of Grapevine fleck virus. J Gen Virol 8:2009‒2015
Sànchez F, C Chay, MA Borja, A Rowhani, J Romero, G Bruening, F Ponz
(1991). cDNA sequence of the capsid protein gene and 3'untranslated region of a
fanleaf isolate of grapevine fanleaf virus. Nucl
Acids Res 19:5440–5440
Villate L, V Fievet, B Hanse, F Delemarre, O Plantard, D Esmenjaud, MV
Helden (2008). Spatial distribution of the dagger nematode Xiphinema index and
its associated Grapevine fanleaf virus
in French vineyard. Phytopathology
8:942‒948
Wines Georgia (2021). Available at: https://winesgeorgia.com/overview/(Accessed:
July 2021)
Zherdev AV, SV Vinogradova, NA Byzova, EV Porotikova, AM Kamionskaya,
BB Dzantiev (2018). Methods for the diagnosis of grapevine viral infections: A
review. Agriculture 12:195